View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_48 (Length: 389)
Name: NF8912A_low_48
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 14396211 - 14396411
Alignment:
| Q |
10 |
aacaatatggaatccttaaagtgacttagggaagcaacaaaatggaaagtgatataagaatccaatttgaaaggaaacttgaattcttaacataaaatcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396211 |
aacaatatggaatccttaaagtgacttagggaagcaacaaaatggaaagtgatataagaatccaatttgaaaggaaacttgaattcttaacataaaatcc |
14396310 |
T |
 |
| Q |
110 |
aaacacatccaatagttgttgaacatgattaagatggagcttcagactaacagatagatgtcttgccacaatgnnnnnnntggaatttggagagtaaatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14396311 |
aaacacatccaatagttgttgaacatgattaagatggagcttcagactaacagatagatgtcttgccacaatg-aaaaaatggaatttggagagtaaatc |
14396409 |
T |
 |
| Q |
210 |
ag |
211 |
Q |
| |
|
|| |
|
|
| T |
14396410 |
ag |
14396411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University