View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912_low_12 (Length: 239)
Name: NF8912_low_12
Description: NF8912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 166 - 223
Target Start/End: Complemental strand, 41653311 - 41653254
Alignment:
| Q |
166 |
catttgcagattcctctgtttcaaattgaacaaagccatatcctttactcttcccatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653311 |
catttgcagattcctctgtttcaaattgaacaaagccatatcctttactcttcccatc |
41653254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 9200340 - 9200430
Alignment:
| Q |
7 |
ttacctgtttataatttaaacatcaaattaaatgttcgaaataata-----tagcatgaatttttataaatcaaaatccagatcttactta |
92 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||| |||| ||| |||||||| |||||||||| ||||||||| || ||||||| |
|
|
| T |
9200340 |
ttacatgtttatactttaaacatcaaatcaaatgttcaaaatgatatacagtagcatgagtttttataaaacaaaatccatatattactta |
9200430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University