View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912_low_17 (Length: 207)
Name: NF8912_low_17
Description: NF8912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 258975 - 259072
Alignment:
| Q |
16 |
aatgtttaatggtagattattgcattgtaaaggagaaggaaattttgcatttatttgttttatcttcttattcttgcactccccagtcttctgatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258975 |
aatgtttaatggtagattattgcattgtaaagatgaaggaaattttgcatttatttgttttatcttcttattcttgcactccccagtcttctgatttt |
259072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 183
Target Start/End: Original strand, 259067 - 259121
Alignment:
| Q |
129 |
gattttcatccatcttgccatttatatgcatacacatcatagcaatattgagatt |
183 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
259067 |
gattttcatccatcttgccattcatatgcatacacatcatagcaatattgagatt |
259121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University