View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8913_high_18 (Length: 240)
Name: NF8913_high_18
Description: NF8913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8913_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 29680876 - 29681096
Alignment:
| Q |
6 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29680876 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
29680975 |
T |
 |
| Q |
106 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaatcttatccatggtggggaatttggtgttgtctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29680976 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaatcttatccattgtggggaatttggtgttgtctg |
29681075 |
T |
 |
| Q |
206 |
ttctccgggaagaagaacctg |
226 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
29681076 |
ttcttcgggaagaagaacctg |
29681096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 29667516 - 29667736
Alignment:
| Q |
6 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtggggaac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29667516 |
atataaatataatggttcaagttgaagatggcgagtcattggatctgaagggtcttggccttaccgtcggggagcgaaaacatcttgcatggtggggaac |
29667615 |
T |
 |
| Q |
106 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaatcttatccatggtggggaatttggtgttgtctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29667616 |
tttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaatcttatccatggtggggaatttggtgttgtctg |
29667715 |
T |
 |
| Q |
206 |
ttctccgggaagaagaacctg |
226 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
29667716 |
ttctccgggatgaagaacctg |
29667736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 3 - 173
Target Start/End: Original strand, 29686673 - 29686842
Alignment:
| Q |
3 |
tagatataaatataatggttcaagttgaagatggcgag--tcattggatctgaagggtctcggccttaccgtcggggaccgaaaacatcttgcatggtgg |
100 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| || |||||||| ||||| ||||||| || ||| |||||||||||||||||||||| | |
|
|
| T |
29686673 |
tagatataaatataacggtgcaagttgaagatggcgagagtccttggatctt---ggtcttggccttatcgccggtgaccgaaaacatcttgcatggtag |
29686769 |
T |
 |
| Q |
101 |
ggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaat |
173 |
Q |
| |
|
|||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29686770 |
ggaacttttttttgttcgtgttgttattggcatcaccggttctctctctaggaggtggcctaataccgaaaat |
29686842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 172
Target Start/End: Complemental strand, 29690442 - 29690370
Alignment:
| Q |
100 |
gggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcctaataccaaaaa |
172 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||| || ||||||||| | ||||||||| |||| |||| |
|
|
| T |
29690442 |
gggaacttagtacctttggttttgttattggcatcaccagtgctctctctacggggtggcctattaccgaaaa |
29690370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 161
Target Start/End: Complemental strand, 29719146 - 29719085
Alignment:
| Q |
100 |
gggaactttgttcctttggtgttgttattggcatcaccggttctctctctaggaggtggcct |
161 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||| || ||||||||| | |||||||| |
|
|
| T |
29719146 |
gggaacttagtacctttggttttgttattggcatcaccagtgctctctctatggggtggcct |
29719085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University