View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8913_high_21 (Length: 216)
Name: NF8913_high_21
Description: NF8913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8913_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 47438456 - 47438651
Alignment:
| Q |
1 |
gatcgcaaaagaagagaaaataaaatcgtattaatacaatatttgaaggactaaaattggtttaacnnnnnnnnnnnnnncagattttccaatatagtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47438456 |
gatcgcaaaagaagagaaaataaaatcgtattaatacaatatttgaaggactaaaattggtttaactttttttattttttcagattttccaatatagtgc |
47438555 |
T |
 |
| Q |
101 |
tactgnnnnnnnnagaagtaaacttaatgcatttaattcaaaatcaaagagtacatcataaaaaatataggactagtgtgggataaagatgctcta |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47438556 |
tactgttttttttagaagtaaacttaatgcatttaattcaaaatcaaagagtacatcataaaaaatataggactagtgtgggataaagatgctcta |
47438651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 37670693 - 37670741
Alignment:
| Q |
151 |
gtacatcataaaaaatatagga-ctagtgtgggataaagatgctctagc |
198 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
37670693 |
gtacatcataaaaaatatgggggctagggtgggataaagatgctctagc |
37670741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University