View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8913_low_43 (Length: 244)
Name: NF8913_low_43
Description: NF8913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8913_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 24207724 - 24207490
Alignment:
| Q |
3 |
agatggacatcatcaaacatttaccaaaaaacaaataacataacatttgcaaaaccatatgttcaaagaagctaaagatatttctgaagtttttaacact |
102 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24207724 |
agatagacaacatcaaacatttaccaaaaaacaaataacataacatttgcaaaaccatatgttcaaagaagctaaagatatttctgaagtttttaacact |
24207625 |
T |
 |
| Q |
103 |
taaaacaaagaagtataatagttaattattcatgctcttctttgctttgagggactcgagagccttattacgcagctcaatctcaagcttctttggatcg |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24207624 |
taaaacaaagaagtataatagttaattgttcatgctcttctttgctttgagggactcgagagccttattacgcagctcaatctcaagcttctttggatcg |
24207525 |
T |
 |
| Q |
203 |
tatggttcttcttcatcatcactttgatgtccatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24207524 |
tatggttcttcttcatcatcactttgatgaccatc |
24207490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University