View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8913_low_55 (Length: 216)
Name: NF8913_low_55
Description: NF8913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8913_low_55 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 24 - 216
Target Start/End: Complemental strand, 383310 - 383116
Alignment:
| Q |
24 |
accattcaacttcattttcttacctctcaaaaaccctaattcaaaatcgagattctattttgtgtattattcctccaagttttttcagtttaaaggatga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
383310 |
accattcaacttcattttcttacctctcaaaaaccctaattcaaaatcgagattctattttgtgtattattcctccaagttttttcagtttaaaggatga |
383211 |
T |
|
| Q |
124 |
aatgaaattgataatata--tatagtttggtttggttgaataaatgaaatgtaatgtaatgttagagtgtgattcaaaaaagtgtgtgcgcgaca |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
383210 |
aatgaaattgataatatatatatagtttggtttggttgaataaatgaaatgtaatgtagtgttagagtgtgattcaaaaaagtgtgtgcgcgaca |
383116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University