View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8914_high_3 (Length: 378)
Name: NF8914_high_3
Description: NF8914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8914_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 31479553 - 31479780
Alignment:
| Q |
14 |
cagagaaacataggaagaaaatgaagagaagatgaaaagagataaatttattcattgctgatggggtggggtgaaggagtgtgaaggtatcagagaaaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31479553 |
cagagaaacataggaagaaaatgaagagaagataaaaagagataaatttgttcattgctgatggggtggggtgaaggagtgtgaaggtataagagaaaca |
31479652 |
T |
 |
| Q |
114 |
ataactttaattataagggtgggctgaaggagtatataaagcagcgcatctgtttcttactgctttaaaaggtatatgaaacaataaatttaattataag |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479653 |
ataactttaattataaggatgggctgaaggagtatataaagcagtgcatgtgtttcttactgctttaaaaggtatatgaaacaataaatttaattataag |
31479752 |
T |
 |
| Q |
214 |
gtaagagattatataaggaacaataatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31479753 |
gtaagagattatataaggaacaataatt |
31479780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 294 - 337
Target Start/End: Original strand, 31479833 - 31479876
Alignment:
| Q |
294 |
ttccttctgattaggaaaaagatttgtgaaggaggggtaatttg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479833 |
ttccttctgattaggaaaaagatttgtgaaggaggggtaatttg |
31479876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University