View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8915_low_10 (Length: 387)
Name: NF8915_low_10
Description: NF8915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8915_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 13 - 369
Target Start/End: Original strand, 32875446 - 32875802
Alignment:
| Q |
13 |
tggtgttcgatatgggactagctaccacgcctgcttgtttcatgagcacattgttgcctccatttgtctatgatgcttcaataatggtaggttacataaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875446 |
tggtgttcgatatgggactagctaccacgcccgcttgtttcatgagcacattgttgcctccatttgtctatgatgcttcaataatggtaggttacataaa |
32875545 |
T |
 |
| Q |
113 |
acttgctagttcaaaattactatacataagtgcttattcaatacgcgtttaactaagttatttttcaacagatgacggcatctcatttgccttacacacg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875546 |
acttgctagttcaaaattactatacataagtgcttattcaatacgcgtttaactaagttatttttcaacagatgacggcatctcatttgccttacacacg |
32875645 |
T |
 |
| Q |
213 |
taatggtttgaaatttttcacaaagagaggggggctgacttcactggaggtagaagaagtatgtgacaaggctgctcgtaaatatgcaaatagattggcc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875646 |
taatggtttgaaatttttcacaaagagaggggggcttacttcactggaggtagaagaagtatgtgacaaggctgctcgtaaatatgcaaatagattggcc |
32875745 |
T |
 |
| Q |
313 |
agagtgtctactctgcttaaagttcttccaacaaaagttgatttcatgagtgcttat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875746 |
agagtgtctactctgcttaaagttcttccaacaaaagttgatttcatgagtgcttat |
32875802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University