View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8916_low_18 (Length: 264)
Name: NF8916_low_18
Description: NF8916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8916_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 35795109 - 35795355
Alignment:
| Q |
18 |
gtaaactctctcaaattagctgtcaccttaaacaaaagtgattatgataagttataaagtaatgcacttccatttttatctctcttcnnnnnnnncttaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35795109 |
gtaaactctctcaaattagctgtcaccttaaacaaaagtgattatgataagttataaagtaatgcacttccatttttatctctcttcttttttttcttaa |
35795208 |
T |
 |
| Q |
118 |
gaccatatttccacgttcatgtgtgtttctgttgtttagttattatactaaatagcatcttacaatttgtttgataaaaattccatgcactctactttgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35795209 |
gaccatatttccacgttcatgtgtgtttctgttgtttagttattatactaaatagcatcttacaatttgtttgataaaaattccatgcactctactttgg |
35795308 |
T |
 |
| Q |
218 |
ttttcatttttgtctagaagtccaaatattgttttagaaattggatt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35795309 |
ttttcatttttgtctagaagtccaaatattgttttagaaattagatt |
35795355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University