View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8917_low_12 (Length: 273)
Name: NF8917_low_12
Description: NF8917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8917_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 34860170 - 34859930
Alignment:
| Q |
18 |
taaaactgatatcatatttcggaagctggaatggactgtgattataggttccttctcatgtgctgatgatagcgctacttttcccgttacttcacttgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860170 |
taaaactgatatcatatttcggaagctggaatggactgtgattataggttccttctcatgtgctgatgatagcgctacttttcccgttacttcacttgag |
34860071 |
T |
|
| Q |
118 |
gatgctcgtagaattccataggatctattgtctcttatgtgtaggtgcatatctgaaactcaccagatgtgtgttactccaacggagttcatacgtagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860070 |
gatgctcgtagaattccataggatctattgtcgcttatgtgtaggtgcatatctgaaactcaccagatgtgtgttactccaacggagttcatacgtagga |
34859971 |
T |
|
| Q |
218 |
agctagatgtttttgaagatccttattgctcgtcttctgtg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859970 |
agctagatgtttttgaagatccttattgctcgtcttctgtg |
34859930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University