View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8918_low_26 (Length: 346)
Name: NF8918_low_26
Description: NF8918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8918_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 38053189 - 38053046
Alignment:
| Q |
17 |
cacagagtggacggaaatataattcaacaaaccaaattaattcgttaggtcgtttgattagtattcgtaatatcaatcattttccatattataaataaca |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38053189 |
cacagagtggtcggaaatataattcaacgaatcaaattaatttgttagatcgtttgattagtattcgtaatatcaatcattttccatattataagtaaca |
38053090 |
T |
|
| Q |
117 |
ttcctaacatgtctaattaatgcaaagtttaacatagaataaag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053089 |
ttcctaacatgtctaattaatgcaaagtttaacatagaataaag |
38053046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 261 - 310
Target Start/End: Complemental strand, 38052670 - 38052621
Alignment:
| Q |
261 |
ttggctttcaacttctgaagcgtggtgaacttatatattcgtttagtggt |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38052670 |
ttggctttcaacttctcaagcgtggtgaacttatatattcgtttagtggt |
38052621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University