View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8918_low_36 (Length: 303)
Name: NF8918_low_36
Description: NF8918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8918_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 4266356 - 4266207
Alignment:
| Q |
5 |
gagaattagtgatatccttctccataataacatcaaaatatacgctagttgacaacaacggtgtaaatataatgatgttagctatccatattgaaggaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266356 |
gagaattagtgatatccttctccataataacatcaaaatatacgctagttgacaacaacggtgtaaatataatgatgttagctatccatattgaaggaga |
4266257 |
T |
|
| Q |
105 |
aattgttaaaattaagtgtgagtagttatttttcatcgaggaatattttg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4266256 |
aattgttaaaattaagtgtgagtagttatttttgatcgaggaatattttg |
4266207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 196 - 237
Target Start/End: Complemental strand, 4265981 - 4265940
Alignment:
| Q |
196 |
ttattttaaatcaccatgaaatgaagtgagatcacgatgatg |
237 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4265981 |
ttattttaaatcactatgaaatgaagtgagatcacgatgatg |
4265940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 4266190 - 4266154
Alignment:
| Q |
168 |
gtgataacttatatatctaaatttaatgttattttaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266190 |
gtgataacttatatatctaaatttaatgttattttaa |
4266154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University