View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8919_low_40 (Length: 299)
Name: NF8919_low_40
Description: NF8919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8919_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 281
Target Start/End: Complemental strand, 52097090 - 52096831
Alignment:
| Q |
21 |
tcaagtgggagcaatttggatgtagcaattatgcaatgatctaccaagtcatatttgagacgcgttagacattaaatatggatctctctgccagccaaaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52097090 |
tcaagtgggagcaatttggatgtagcaattatgcaatgatctacctaatcatatttgagacgcattagacattaaatatggatctctctaccagccaaaa |
52096991 |
T |
|
| Q |
121 |
ttcaaatctagattcgtcacattgcggaagtctaagccatttccgatagagaaagttgtcgcttatcctttgttgatcttgttttatttctttcttttca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52096990 |
ttcaaatctagattcgtcacattgcggaagtct-agccatttccgatagagaaagttgtcgcttatcctttgtagatcttgttttatttctttcttttca |
52096892 |
T |
|
| Q |
221 |
ttcttttaaagtgttctagggaaagcatgtccgattgtctttctttgtaactatatgaatg |
281 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52096891 |
ttcttttaaagtattctagggaaagcatgtccgattgtctttctttataactatatgaatg |
52096831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University