View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8919_low_50 (Length: 250)
Name: NF8919_low_50
Description: NF8919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8919_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 22369331 - 22369270
Alignment:
| Q |
77 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22369331 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt |
22369270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22369407 - 22369364
Alignment:
| Q |
1 |
tcatatcattttcaatatagtcaaaggtatcggttagtactcca |
44 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22369407 |
tcatatcattttcaatatagtcaaagatatcggttagtactcca |
22369364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University