View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8919_low_50 (Length: 250)

Name: NF8919_low_50
Description: NF8919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8919_low_50
NF8919_low_50
[»] chr5 (2 HSPs)
chr5 (77-138)||(22369270-22369331)
chr5 (1-44)||(22369364-22369407)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 22369331 - 22369270
Alignment:
77 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22369331 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttt 22369270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22369407 - 22369364
Alignment:
1 tcatatcattttcaatatagtcaaaggtatcggttagtactcca 44  Q
    |||||||||||||||||||||||||| |||||||||||||||||    
22369407 tcatatcattttcaatatagtcaaagatatcggttagtactcca 22369364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University