View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8920_high_6 (Length: 264)
Name: NF8920_high_6
Description: NF8920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8920_high_6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 264
Target Start/End: Complemental strand, 1741630 - 1741378
Alignment:
| Q |
13 |
gtgttgatgtcagacaccggacacaccttcaacctgaggtttcaatgctacaaagcaactattaagcttgactct-aaagtactccatcgaacaacatta |
111 |
Q |
| |
|
|||||||||||||||| |||||||| | |||||||||||||| | ||||||||||||||||||| |||||| || ||||||||||||||| |||||||| |
|
|
| T |
1741630 |
gtgttgatgtcagacatcggacacaacgtcaacctgaggttttgaagctacaaagcaactattaaacttgacactgaaagtactccatcgagcaacatta |
1741531 |
T |
 |
| Q |
112 |
cttgcaatttttccttcgttgttctcttgactcaacgatttctctgatacaactattgatatctcacaagaatttccttaacagatgatctcctcactaa |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1741530 |
cttgcaatttttccttcgtttttctcttgactcaacgatttctctgatacaattattgttatctcacaagaacttccttaaaagatgatctcctcactaa |
1741431 |
T |
 |
| Q |
212 |
ttaatgacttctttatttttctgttaataacaatttctcttatctttcacatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
1741430 |
ttaatgacttctttatttttctgttaagaacaatttctcttatcattcacatt |
1741378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 30711709 - 30711667
Alignment:
| Q |
19 |
atgtcagacac-cggacacaccttcaacctgaggtttcaatgc |
60 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
30711709 |
atgtcagacactcggacacgccttcaacctgaggtttcaatgc |
30711667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University