View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8920_high_8 (Length: 238)
Name: NF8920_high_8
Description: NF8920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8920_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 32426216 - 32426419
Alignment:
| Q |
18 |
ctcgacttcaccggtgaaacctcaacctcgtcggatttctcttcagcttctaccccctcagctttccggcgaagctgaatctcttcaacctctttctgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32426216 |
ctcgacttcaccggtgaaacctcaacctcgtcggatttctcttcagcttctaccccctcagctttccggcgaagctgaatctcttcaacctctttctgct |
32426315 |
T |
 |
| Q |
118 |
tagcttgaatcctcgaactcgatctccgttgcaacgacattggtatcacctctgtcgtcgtagcatccttcgattcatctctcagcttcttcccaccgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
32426316 |
tagcttgaatcctcgaactcgatctccgttgcaacgacattggtgtcacctccgtcgtcgtagcatccttagattcatctctcagcttctttccaccgta |
32426415 |
T |
 |
| Q |
218 |
tttc |
221 |
Q |
| |
|
|||| |
|
|
| T |
32426416 |
tttc |
32426419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 174
Target Start/End: Original strand, 21289237 - 21289390
Alignment:
| Q |
21 |
gacttcaccggtgaaacctcaacctcgtcggatttctcttcagcttctaccccctcagctttccggcgaagctgaatctcttcaacctctttctgcttag |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21289237 |
gacttcaccggtgaaacctcaacctcatcggatttctcttcagcttctaccccctcagctttccggcgaagctgaatctcttgaacctctttctgcttag |
21289336 |
T |
 |
| Q |
121 |
cttgaatcctcgaactcgatctccgttgcaacgacattggtatcacctctgtcg |
174 |
Q |
| |
|
|||||||||||||||| ||||| || ||| |||||||||| ||||||| |||| |
|
|
| T |
21289337 |
cttgaatcctcgaactagatcttcgctgcgacgacattggcgtcacctcagtcg |
21289390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 159
Target Start/End: Complemental strand, 21239474 - 21239333
Alignment:
| Q |
18 |
ctcgacttcaccggtgaaacctcaacctcgtcggatttctcttcagcttctaccccctcagctttccggcgaagctgaatctcttcaacctctttctgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21239474 |
ctcgacttcaccggtgaaacctcaacctcattggatttctcttcagcttctaccccctcagctttccgacgaagctgaatctcttcaacctctttctgct |
21239375 |
T |
 |
| Q |
118 |
tagcttgaatcctcgaactcgatctccgttgcaacgacattg |
159 |
Q |
| |
|
| ||||||||||||||||| ||||| || ||| ||||||||| |
|
|
| T |
21239374 |
tggcttgaatcctcgaactagatcttcgctgcgacgacattg |
21239333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University