View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8920_low_17 (Length: 265)
Name: NF8920_low_17
Description: NF8920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8920_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 5002532 - 5002779
Alignment:
| Q |
18 |
aaacctgtaaaactcctagaagaacatcgaaacgttttcccaattccagccaggtatgaaatactcagcttcttttcctaattacttttgattttttcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5002532 |
aaacctgtaaaactcctagaagaacatcgaaacgttttcccagttccagccaggtatgaaatactcagcttcttttcctaattacttttgattttttcct |
5002631 |
T |
|
| Q |
118 |
ttgaacgtgctcaatcttttgtttctcataaaaacccagcttcttgtaaagtcttttttcacttttccccctcctttctcgttctttatttgttttaatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5002632 |
ttgaacgtgctcaatcttttgtttctcataaaaacccagcttcttgtaaagtcttttttcacttttccccctcctttttcgttctttatttgttttaatg |
5002731 |
T |
|
| Q |
218 |
gttattggttaatgcatgctttcgcctaacacaattccttgactagtt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5002732 |
gttattggttaatgcatgctttcgcctaacacaattccttgactagtt |
5002779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University