View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_high_48 (Length: 223)
Name: NF8921_high_48
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 37 - 209
Target Start/End: Original strand, 30120707 - 30120879
Alignment:
| Q |
37 |
tggacttggtaaattttatatttgtatatggaaaaaattgaataaatggaattggtaagaggagaaagtggtgtctagtgagttccacttttttgaccaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30120707 |
tggacttggtaaattttatatttgtatatggaaaaaattgaataaatggaattggtaagaggagaaagtggtgtctagtgagttccacttttttgaccaa |
30120806 |
T |
 |
| Q |
137 |
aaccaaaatgtattagaaaagtcttccactctttctattaacctttgcaactttcatttcttcatcacaaaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30120807 |
aaccaaaatgtattagaaaagtcttccactctttctattaacctttgcaactttcatttcttcatcacaaaag |
30120879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University