View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_100 (Length: 288)
Name: NF8921_low_100
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_100 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 36547644 - 36547931
Alignment:
| Q |
1 |
gaagattacatcataagaatcttgtgggtttggtgggatatgcagcagaaagaggacgacacatgcttctttacatttatatgagcaacggtagtcttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36547644 |
gaagattacatcataagaatcttgtgggtttggtgggatatgcagcagaaagaggacgacacatgcttctttacatttatatgatcaacggtagtcttgc |
36547743 |
T |
 |
| Q |
101 |
ttctcatttgtatggtaagaaaaagagcaattcttgtcctttaatatttgtagggagtattttgtgcggatatttgctcggtggtatacatgttctcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36547744 |
ttctcatttgtatggtaagaaaaagagcaattcttgtcctttaatatttgtagggagtattttgtgcggatatttgctcggtggtatacatgttctcact |
36547843 |
T |
 |
| Q |
201 |
attcaattgctcaataatagctaaaaaatttagcttgaactcttctggttatttgttttacttacctttgtgttgatgatccaggcga |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36547844 |
attcaattgctcaataatagctaaaaaatttagcttgaactcttctggttatttgttttacttacctttgtgttgatgatccaggcga |
36547931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University