View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_106 (Length: 268)
Name: NF8921_low_106
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_106 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 1701819 - 1702008
Alignment:
| Q |
1 |
aagtgaaatggcagagaagccattgttggtgagatcatcttggtcaaaagaatgcttcttggcacgtcgttcggaggaagatgacgccattgaacgacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1701819 |
aagtgaaatggcagagaagccattgttggtgagatcatcttggtcaaaagaatgcttcttggcacgtcgttcggaggaagatgacgccattgaacgacgt |
1701918 |
T |
|
| Q |
101 |
ttggtggaggttttgtgacggtggcgaggtgaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1701919 |
ttggtggaggttttgtgacggtggcgaggtgaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac |
1702008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University