View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_116 (Length: 251)
Name: NF8921_low_116
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_116 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 401274 - 401524
Alignment:
| Q |
1 |
gatgcctacatctttcttgagtctttttataacatccccgatgcagtaggagaaatcttcttcactaacatctggatggatgtactcatagttgatatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401274 |
gatgcctacatctttcttgagtctttttataacgtacccgatgcagtaggagaaatcttcttcactaacatctggatggatgtactcatagttgatatca |
401373 |
T |
 |
| Q |
101 |
atgccatcaattaaattgtagcaggagttggttctgttgtataattggaagannnnnnnaagggattcgacagcattgtcacaccattcgagtttgtgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401374 |
atgccatcaattaaattgtagcaggagttggttctgttgtataattggaagatttttttaagggattcgacagcattgtcacaccattcgagtttgtgtg |
401473 |
T |
 |
| Q |
201 |
caggatggaatggatatttagtatcacggcctccaatgcttattaccacct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401474 |
caggatggaatggatatttagtatcacggcctccaatgcttattaccacct |
401524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University