View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_126 (Length: 240)
Name: NF8921_low_126
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_126 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 234
Target Start/End: Complemental strand, 22045996 - 22045789
Alignment:
| Q |
26 |
ctttgatactcttttatgccaaaatataacacaaagctacaatcatatcaaccattatacccatagatttgtacttaagttgagaatattcatgatgttg |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22045996 |
ctttgatactcttttatgctaaaatataacacaaagctactatcatatcaaccatcatactctt-gatttgtacttaagttgagaatattcatgatgttg |
22045898 |
T |
|
| Q |
126 |
tacgttgttgcatgttttgtttcccaataagagataacaccagcacaaatacacgccacatgcaaatttggtttctcaagcacacaagtattccttatca |
225 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22045897 |
tactttgttgcatgttttgttttccaataagagataacaccagcacaaatacacgtcacatgcaaatttggtttctcaagcaaacaagtattccttatca |
22045798 |
T |
|
| Q |
226 |
ttgcattct |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
22045797 |
ttgcattct |
22045789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University