View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_136 (Length: 221)
Name: NF8921_low_136
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_136 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 41853936 - 41854154
Alignment:
| Q |
1 |
aaatgcaatttatacataattcaagaattcttatggttttttcttaagcatgatattagaattcctctcaccttggatgtttggtgccaaggatatcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41853936 |
aaatgcaatttatacataattcaagaattcttatggttttttcttaagcatgatattagaattcctctcaccttggatgtttggtgccaaggatatcttt |
41854035 |
T |
 |
| Q |
101 |
ctgaccatattttctccagttgtagccatcttcatttggtccttcaaggctactgtcacagctcactcttatctgatccatccatttgggcgcaaccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854036 |
ctgaccatattttctccagttgtagccatcttcatttggtccttcaaggctactgtcacagctcactcttatctgatccatccatttgggcgcaaccttt |
41854135 |
T |
 |
| Q |
201 |
ctgaaagcaatttcaggaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41854136 |
ctgaaagcaatttcaggaa |
41854154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 118
Target Start/End: Original strand, 41261569 - 41261617
Alignment:
| Q |
70 |
accttggatgtttggtgccaaggatatctttctgaccatattttctcca |
118 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41261569 |
accttggatgcatggctccaaggatgtctttctgaccatattttctcca |
41261617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University