View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_149 (Length: 205)
Name: NF8921_low_149
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 189
Target Start/End: Original strand, 39783473 - 39783650
Alignment:
| Q |
12 |
agcagagacatatgcaacttcaatatcagtaacggagacatcaaataccttgaactactaatacttatagaaagaataacgtggaggaatagatatagaa |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783473 |
agcaaagacatatgcaacttcaatatcagtaatggagacatcaaataccttgaactactaatacttatagaaagaataacgtggaggaatagatatagaa |
39783572 |
T |
 |
| Q |
112 |
gtacctgttgtttgaaagtttcttcatgctttaacatggccatcctcatgtattctttgtcacgtgacctaacaagct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39783573 |
gtacctgttgtttgaaagtttcttcatgctttaacatggccatcctcatgtattctttgtcacatgacctaacaagct |
39783650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University