View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_88 (Length: 318)
Name: NF8921_low_88
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 164 - 292
Target Start/End: Original strand, 29631638 - 29631766
Alignment:
| Q |
164 |
ctcagcagctagctattgcaatacaacggactgtgataacgctggaaacgacaaacacacgtcgttttcagatctcggactctcggaatggatggtgcgg |
263 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29631638 |
ctcagcagctagctattgtaatacaacggactgtgataacgctggaaacgacaaacacatgtcgttttcagatctaggactctcggaatggatggtgcgg |
29631737 |
T |
|
| Q |
264 |
ggttgcgataaactcgggatgcaatctcc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29631738 |
ggttgcgataaactcgggatgcaatctcc |
29631766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 29631491 - 29631603
Alignment:
| Q |
16 |
ctgtgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631491 |
ctgtgaaatggattctaaacctggcagccgcacatggatttctcccataaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgt |
29631590 |
T |
|
| Q |
116 |
aacagcttacttc |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29631591 |
aacagcttacttc |
29631603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 28390281 - 28390248
Alignment:
| Q |
227 |
gttttcagatctcggactctcggaatggatggtg |
260 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
28390281 |
gttttcagatctcggactctcagaatggatggtg |
28390248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University