View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8921_low_96 (Length: 300)
Name: NF8921_low_96
Description: NF8921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8921_low_96 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 35841800 - 35842081
Alignment:
| Q |
9 |
gagatgaaaattgaagtcacattcattgaataagaaacagacaaggctagatcatttgccaaaagaaaacagttcacttgaaacccctgaatcttctggt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35841800 |
gagacgaaaattgaagtcacattcattgaataagaaacagacaaggctagatcatttgccaaaagaaaacagttcgcttgaaacccctgaatcttctggt |
35841899 |
T |
|
| Q |
109 |
ggcttttctccgatggatttgtctccctatcaggaaacaacagcagatgatgaagatctaaagccttcagaagaatcaaatgttctgcacccaacaattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35841900 |
ggcttttctccgatggatttgtctccctatcaggaaacaacagcagatgatgaagatctaaaggcttcagaagaatcaaatgttctgcacccaacaattg |
35841999 |
T |
|
| Q |
209 |
ctaccgattgtaaagacagtcagagaggtggagatcttgataatggcaagtcctgttatggaagttcttctgtaggtgatgt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35842000 |
ctaccgattgtaaagacagtcagagaggtggagatcttgataatggcaagtcctgttatggaagttcttctgtaggtgatgt |
35842081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University