View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8922_low_21 (Length: 320)
Name: NF8922_low_21
Description: NF8922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8922_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 26 - 304
Target Start/End: Original strand, 42596036 - 42596322
Alignment:
| Q |
26 |
tggcggttcaaggtggagatgggtggcttgtggctgcattggtggttggaggaggccatggtcagctggcagatgtgctgttaatggtggttctagaagg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42596036 |
tggcggttcaaggtggagatgggtggcttgtggctgcattggtggttggaggaggccatggtcggctggcagatgtgctgttaatggtggttctagaagg |
42596135 |
T |
 |
| Q |
126 |
atatgcgtcaatgcggaaggttggggatagtgctcattgaaagctc--------gattggggctgtcttgtaacactgtctgtataatcataatctgcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42596136 |
atatgcgtcaatgcggaaggttggggatagtgctcattgaaagctcgactgggagattggggctgtcttgtaacactgtctgtataatcataatctgcat |
42596235 |
T |
 |
| Q |
218 |
atattcaacgatctttagttttgtttcacgaaaaaccagtcattgagatagttcattctagttctttctcttgtatacattggttct |
304 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42596236 |
atattcaacgatctttagtgttgtttcacgaaaaaccagtcattgagatagttcattctagttctttctcttgtatacattggttct |
42596322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University