View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_high_16 (Length: 257)
Name: NF8923_high_16
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 8404636 - 8404869
Alignment:
| Q |
16 |
agtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccaccggaagaaactatgcttgtaagtccatttcgagac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8404636 |
agtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccactggaagaaactatgcttgtaagtccatttcgagac |
8404735 |
T |
 |
| Q |
116 |
gaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatggtccttcaggacttaagtggacaaccaaacatagttgagttcaagggtgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404736 |
gaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatgatccttcaggacttaagtggacaaccaaacatagttgagttcaagggtgc |
8404835 |
T |
 |
| Q |
216 |
ttatgaggatagagagagtgtgcatttggtgatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8404836 |
ttatgaggatagagagagtgtgcatttggtgatg |
8404869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 40531981 - 40532026
Alignment:
| Q |
181 |
agtggacaaccaaacatagttgagttcaagggtgcttatgaggata |
226 |
Q |
| |
|
|||||||||||||| || |||||||| || |||||||||||||||| |
|
|
| T |
40531981 |
agtggacaaccaaatattgttgagtttaaaggtgcttatgaggata |
40532026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 40536946 - 40536990
Alignment:
| Q |
181 |
agtggacaaccaaacatagttgagttcaagggtgcttatgaggat |
225 |
Q |
| |
|
|||||||||||||| || |||||||| || ||||||||||||||| |
|
|
| T |
40536946 |
agtggacaaccaaatattgttgagtttaaaggtgcttatgaggat |
40536990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University