View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_high_3 (Length: 549)
Name: NF8923_high_3
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 490; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 490; E-Value: 0
Query Start/End: Original strand, 1 - 538
Target Start/End: Original strand, 4588213 - 4588755
Alignment:
| Q |
1 |
accaacccattttgtcaccacaggattctgtttcaggaatcaaagctggtgtggctgcagggatgcctgttataggtatatctactcgaaacccagaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588213 |
accaacccattttgtcaccacaggattctgtttcaggaatcaaagctggtgtggctgcagggatgcctgttataggtatatctactcgaaacccagaaga |
4588312 |
T |
 |
| Q |
101 |
cttgcttatgggagcaaaacctgcctttttgattaaggattatgatgatccaaaactgtgggcggcattggaagaacttgacaagtctggttctcattaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588313 |
cttgcttatgggagcaaaacctgcctttttgattaaggattatgatgatccaaaactgtgggcagcattggaagaacttgacaagtctggttctcattaa |
4588412 |
T |
 |
| Q |
201 |
aattttgaattactagtccaattgacataatttcttgataaaaacaagtagcaggtttcatattaaattcaccggatcacctgtataattttgttgcann |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588413 |
aattttgaattactagtccaattgacataatttcttgataaaaacaagtagcaggtttcatattaaattcaccggatcacctgtataattttgttgcagg |
4588512 |
T |
 |
| Q |
301 |
nnnnntgatattattatactagtccataatcagcgttgctttgaaatcgagcaaacattagctttatttgtattttgtaataatgtgatagttggctatg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588513 |
gggggtgatattattatactagtccataatcagtgttgctttgaaatcgagcaaacattagttttatttgtattttgtaataatgtgatagttggctatg |
4588612 |
T |
 |
| Q |
401 |
atggtcaatgccaaggaat-----tgcaatacacgtgagagatagtgagggaggaagggagggattttaatactcttccattattcattacactttatag |
495 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588613 |
atggtcaatgccaaggaattgcaatgcaatacacgtgagagatagtgagggaggaagggagggattttaatactcttccattattcattacactttatag |
4588712 |
T |
 |
| Q |
496 |
attatgatttttgctcaactttttgtccgtatgttttctgatg |
538 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588713 |
attatgatttttgctcaactttttgtccgtatgttttctgatg |
4588755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University