View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_low_22 (Length: 302)
Name: NF8923_low_22
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 4587966 - 4588236
Alignment:
| Q |
18 |
gattgaagcgagctgcagttaccaatgctccaagaccaaatgcagaactcattctctcaaagcttggtctctcagatttctttcatgctgttattattgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4587966 |
gattgaagcgagctgcagttaccaatgctccaagaccaaatgcagaactcattctctcaaagcttggtctctcagatttctttcatgctgttattattgg |
4588065 |
T |
|
| Q |
118 |
tgatgaatgtgaacatgccaagcctcatccagaaccctacttgaaaggtctcgaagctctcaaagcatctaaggatcacacatttatatttgaggtctgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588066 |
tgatgaatgtgaacatgccaagcctcatccagaaccctacttgaaaggtcttgaagctctcaaagcatctaaggatcacacatttatatttgaggtctgt |
4588165 |
T |
|
| Q |
218 |
tttcttttctacgcctcgctacagagtttgttcttattctgcttctaaccaacccattttgtcaccacagg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4588166 |
tttcttttctacgcctcgctacagagtttgttcttattctgcttctaaccaacccattttgtcaccacagg |
4588236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University