View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_low_39 (Length: 233)
Name: NF8923_low_39
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 155 - 218
Target Start/End: Original strand, 36487520 - 36487583
Alignment:
| Q |
155 |
ataattcatccaaccatttcaaaactaccaggaattcgaaccagggattgattctctcaccttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36487520 |
ataattcatccaaccatttcaaaactaccaggaattcgaaccagggattgattctctcaccttt |
36487583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 36487379 - 36487424
Alignment:
| Q |
12 |
catcatcacgcgttgctcgaggttagcgtgttgtgtcagattcgta |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36487379 |
catcatcacgcgttgctcgaggttagcgtattgtgtcagattcgta |
36487424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University