View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_low_40 (Length: 228)
Name: NF8923_low_40
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 12 - 122
Target Start/End: Original strand, 39163706 - 39163816
Alignment:
| Q |
12 |
catcagcagcatccttgaatttatcacatatggtagcaactttcttataatcaagtgcatagtagtttttctcccttatgacaggattcatgaaattctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39163706 |
catcagcagcatccttgaatttatcacaaatggtagcaactttcttataatcaagtgcatagtagtttttctcccttatgacaggattcatgaaattctc |
39163805 |
T |
 |
| Q |
112 |
aggctgactac |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
39163806 |
aggctgactac |
39163816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 119 - 215
Target Start/End: Complemental strand, 39164089 - 39163993
Alignment:
| Q |
119 |
ctacagcgcaacaagttttacctttggaagctatgtacaaagttggaactggtgcacttgaccatgtttccaatataattatgactgcttttcttag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39164089 |
ctacagcgcaacaagttttacctttggaagctatgtacaaagttggaactggtgcacttgagcatgtttccaatataattatgactgcttttcttag |
39163993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 19511593 - 19511493
Alignment:
| Q |
22 |
atccttgaatttatcacatatggtagcaactttcttataatcaagtgcatagtagtttttctcccttatgacaggattcatgaaattctcaggctgacta |
121 |
Q |
| |
|
|||||||||||||||||| |||| || ||| ||||| ||||| | ||||||||| ||||||||||||| ||||||||||||| | ||||| |||||| |
|
|
| T |
19511593 |
atccttgaatttatcacagatggcagaaaccttcttgtaatccaatgcatagtaacttttctcccttatatcaggattcatgaagtcctcagcttgacta |
19511494 |
T |
 |
| Q |
122 |
c |
122 |
Q |
| |
|
| |
|
|
| T |
19511493 |
c |
19511493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University