View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8923_low_43 (Length: 227)
Name: NF8923_low_43
Description: NF8923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8923_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 25602871 - 25602659
Alignment:
| Q |
1 |
tcccggttagaggtatactcaattacccttataatttattatgcaaattttgttcaattcaattataagttataacccnnnnnnnncattgttcacttat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25602871 |
tcccggttagaggtaaactcaattacccttataatttattatgcaaattttgttcaattcaattataagttataacccttttttttcattgttcacttat |
25602772 |
T |
 |
| Q |
101 |
tgttctttcatcccttgaatgcttcaaatcgcaatcaatcattcattttggatattgtaattctttatgatatttctctgcaaatattttgtatagttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25602771 |
tgttctttcatcccttgaatgcttcaaatcgcaatcattcattcattttggatattgtaattctttatgatatttctc-gcaaatattttgtatagtttt |
25602673 |
T |
 |
| Q |
201 |
tgaatttcatattg |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25602672 |
ggaatttcatattg |
25602659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University