View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_high_22 (Length: 250)
Name: NF8924_high_22
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_high_22 |
 |  |
|
| [»] scaffold0267 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0267 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0267
Description:
Target: scaffold0267; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 28 - 232
Target Start/End: Original strand, 15568 - 15772
Alignment:
| Q |
28 |
aggtggttcagctggtggtggtgatgttgtgtcaggtggcaaagttgtgtccggaggtgaagctggtggaaaactagttcactttgatggaacttttgtg |
127 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15568 |
aggtggttcagctggtggtggtgaagttgtgtcaggtggcgaagttgtgtctggaggtgaagctggtggaaaactagttcactttgatggaacttttgtg |
15667 |
T |
 |
| Q |
128 |
ttcacttctgtgcaactgctgagataatgggaaaaagtgcgtatggaacaacttacaaggcaacataggaaaatggtaatcaagttgctgtgaagaggtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15668 |
ttcacttctgtgcaactgctgagataatgggaaaaagtgcttatggaacaacttacaaggcaacataggaaaatggtaatcaagtttctgtgaagaggtt |
15767 |
T |
 |
| Q |
228 |
gcttt |
232 |
Q |
| |
|
||||| |
|
|
| T |
15768 |
gcttt |
15772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 136 - 224
Target Start/End: Original strand, 3906825 - 3906913
Alignment:
| Q |
136 |
tgtgcaactgctgagataatgggaaaaagtgcgtatggaacaacttacaaggcaacataggaaaatggtaatcaagttgctgtgaagag |
224 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3906825 |
tgtgcaactgctgagataatgggcaaaacagcttatggaacagcttacaaggcaacattggaagatggtaatcaagttgctgtgaagag |
3906913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 132
Target Start/End: Original strand, 3906756 - 3906808
Alignment:
| Q |
80 |
ggaggtgaagctggtggaaaactagttcactttgatggaacttttgtgttcac |
132 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||||||| | ||||||||||| |
|
|
| T |
3906756 |
ggaggtgaagccggtggcaagctggttcactttgatggaccatttgtgttcac |
3906808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University