View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_40 (Length: 320)
Name: NF8924_low_40
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 294
Target Start/End: Complemental strand, 30114270 - 30113992
Alignment:
| Q |
17 |
tatttaagaaaagtccgacaagtattcttgaagttatcgagtgatgagagagacattggtgttttctttaagatctttgtcgttgataagnnnnnnnggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
30114270 |
tatttaagaaaagtccgacaagtattcttgaagttatcgagtgatgagagggacattggtgttttctttaagatctttgacgttgataagtttttt-ggc |
30114172 |
T |
 |
| Q |
117 |
tcatatgtgagcgttccccatactattgttgtttgtcgtttctaaagttatcacaaatttctatttgatggcctcatatgaatcagttcaaagcacttc- |
215 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30114171 |
tcatatgtgagcttcccccatactcttgttgtttgtcgtttctaaagttatcacaaatttctatttgatggcctcctatgaatcagttcaaagcacttct |
30114072 |
T |
 |
| Q |
216 |
-ttannnnnnnnaggggtacttcttaacttatattcggtcatttttataaacaaatgaataatttattatctcatttaaa |
294 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30114071 |
ttttatttttttaggggtgcttcttaacttatattcggtcatttttataaacaaatgaataatttattatctcatttaaa |
30113992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University