View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_44 (Length: 313)
Name: NF8924_low_44
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 256
Target Start/End: Complemental strand, 32077253 - 32077009
Alignment:
| Q |
12 |
agtttatgcagttagaaatacattttatatgacgagttttatcatcccaacctcgtgctgctgcagacctccagctagccaatctcttttgtcaataacg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077253 |
agtttatgcagttagaaatacattttatatgacgagttttatcatcccaacctcgtgctgctgcagacctccagctagccaatctcttttgtcaataacg |
32077154 |
T |
 |
| Q |
112 |
atgatggacatacctggttatgcagctattgaatatatgcaaaataggtaactcattcatgtcttcaatgttatttagtgcaagtgatgtatcaatctag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077153 |
atgatggacatacctggttatgcagctattgaatatatgcaaaataggtaactcattcatgtcttcaatgttatttagtgcaagtgatgtatcaatctag |
32077054 |
T |
 |
| Q |
212 |
cttatatgttgatatgtttggttgaagttaaattatgcataatgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077053 |
cttatatgttgatatgtttggttgaagttaaattatgcataatgt |
32077009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 277 - 313
Target Start/End: Complemental strand, 32077025 - 32076989
Alignment:
| Q |
277 |
taaattatgcataatgtgaaatgtgtttgctgtcata |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077025 |
taaattatgcataatgtgaaatgtgtttgctgtcata |
32076989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University