View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_54 (Length: 249)
Name: NF8924_low_54
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 54 - 234
Target Start/End: Complemental strand, 46758968 - 46758788
Alignment:
| Q |
54 |
tcaccactttccccatgagcaagatacataacctcatgagtttgttcacttgagcaacaaactatcttcactttagaaccctcttcaacaccctctacca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46758968 |
tcaccactttccccatgagcaagatacataacctcatgagtttgttcacttgagcaacaaactatcttcactttagaaccctcttcaacaccctctacca |
46758869 |
T |
 |
| Q |
154 |
cagaaacctcttcactcaataccttttcatcctttacaacaccaatagaaccatcctcattctccactaccacagcatgat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46758868 |
cagaaacctcttcactcaataccttttcatcctttacaacaccaatagaaccatcctcattctccactaccacagcatgat |
46758788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University