View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8924_low_55 (Length: 241)

Name: NF8924_low_55
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8924_low_55
NF8924_low_55
[»] chr2 (1 HSPs)
chr2 (20-223)||(23386546-23386749)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 23386749 - 23386546
Alignment:
20 agttaggatgcgatattatgtatatataagataatgtcgtcatattattatttaaggtggggttcaggagttattggattctgttgcagtctgccacata 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23386749 agttaggatgcgatattatgtatatataagataatgtcgtcatattattatttaaggtggggttcaggggttattggattctgttgcagtctgccacata 23386650  T
120 tataagaacttcccctcataacacctcataccatggatatgttctgcaataatgcattggaatcgttaaaagaagggcaaaagaggggttttgtatgaaa 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||    
23386649 tataagaacttcccctcataacacctcataccatggatatgttctgcaataatgcattggaatcgtttaaagaagggcaaaagaggggttttgtatgtaa 23386550  T
220 aaag 223  Q
    ||||    
23386549 aaag 23386546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University