View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_62 (Length: 232)
Name: NF8924_low_62
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 215
Target Start/End: Original strand, 37510484 - 37510687
Alignment:
| Q |
12 |
gattatactctttggtcaaatcaatggaaaaaacacggtctatgttcctatccaacatttgatatacatcaatacttctcggttgcattatataattggg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37510484 |
gattatactctttggtcaaatcaatggaaaaaacacggtctatgttcctatccaacatttgatatacatcaatacttctcggttgcattatataattggg |
37510583 |
T |
 |
| Q |
112 |
gaagtcgcaatcttagagatgatcttggacgctatggtattaggcctctagcatatacccttgaagcaatagaaaaaagtgttggctttacacctcaact |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37510584 |
gaagtcgcaatcttacagatgatcttggacgctatggtattaggcctctagcatatacccttgaagcaatagaaaaaagtgttggctttacacctcaact |
37510683 |
T |
 |
| Q |
212 |
tatt |
215 |
Q |
| |
|
|||| |
|
|
| T |
37510684 |
tatt |
37510687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University