View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_68 (Length: 205)
Name: NF8924_low_68
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 25955930 - 25955757
Alignment:
| Q |
18 |
tattttgctgctgcagttgtcaaagattctatctatgtgattggtggtgttaatggtgatgaaaatattgtagatactgtaagtaaatctattgacctta |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25955930 |
tattttgctgctgcagtcgtcaaagattctatctatgtgattggtggtgttaatggtgatgaaaatattgtagatactgtaagtaaatctattgacctta |
25955831 |
T |
|
| Q |
118 |
gtcttttgcctttggttatacacttggtattaatatcacattcatattctatacttgcatatatgcacacaggt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25955830 |
gtcttttgcctttggttatacacttggtattcatatcacattcatattctatacttgcatatatgcacacaggt |
25955757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University