View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8924_low_69 (Length: 202)
Name: NF8924_low_69
Description: NF8924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8924_low_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 34897804 - 34897982
Alignment:
| Q |
7 |
agtggagaagcagaggacggcacaagggtggcgattaaaatcctgcaaacggtttccacttccatcccattgcacaagtaagccatttgtacatccactc |
106 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34897804 |
agtgcagaagcattggacggcacaagggtggcgattaaaatcctgcaaacggtttccacttccatcccattgcacaagtaagccatttgtacatccactc |
34897903 |
T |
 |
| Q |
107 |
caaactatcccatcgtttgtttgcacaagggcttccgttcttttagtatcatcaacaaatgctccagctcccttagttg |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34897904 |
caaattatcccatcgtttgtttgcacaagggcttccgttcttttagtatcatcaacaaatgctccagctcccttggttg |
34897982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University