View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_high_23 (Length: 240)
Name: NF8926_high_23
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 279369 - 279171
Alignment:
| Q |
25 |
tcaaaagatatttcatgaaagaaggagccaagccaattgaattttaattaaccaaaccaacnnnnnnnntcaaattcaggaacagcaagaaaagtagcta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
279369 |
tcaaaagatatttcatgaaagaaggagccaagccaattgaattttaattaaccaaaccaacaaaaaaaatcaaattcaggaacagcaagaaaagtagcta |
279270 |
T |
 |
| Q |
125 |
tggttttgcttggatgcagtgttgctattgttaatatcataaacaacgagagctaatatagcacattgagccgtcaactggcgtctggcgctatcaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
279269 |
tggttttgcttggatgcagtgttgctattgttaatatcataaacaacgagagctaatatagcacattgagccgtcaactggcgtctggcactatcaaaa |
279171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 265637 - 265576
Alignment:
| Q |
95 |
caaattcaggaacagcaagaaaagtagctatggttttgcttggatgcagtgttgctattgtt |
156 |
Q |
| |
|
||||||||||||||||||||||| |||| | | |||||||||||| || ||||| |||||| |
|
|
| T |
265637 |
caaattcaggaacagcaagaaaaatagcctttgctttgcttggatgtagagttgccattgtt |
265576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University