View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_40 (Length: 314)
Name: NF8926_low_40
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 115 - 296
Target Start/End: Complemental strand, 36127961 - 36127780
Alignment:
| Q |
115 |
caaagagcttgagttgatggcacatgaacaagctattgctggtgatagacaagcacatataattcaattcttgaacaaattctcgacaagtgctaattct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127961 |
caaagagcttgagttgatggcacatgaacaagctattgctggtgatagacaagcacatataattcaattcttgaacaaattctcgacaagtgctaattct |
36127862 |
T |
|
| Q |
215 |
tcatccctagcttcaatgtcaactcaacttcaagcttatttagcaacattaacttcaaactcttcttcttcaacattgcact |
296 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127861 |
tcatccctaacttcaatgtcaactcaacttcaagcttatttagcaacattaacttcaaactcttcttcttcaacattgcact |
36127780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 36128071 - 36128030
Alignment:
| Q |
5 |
gatcaacaagaagaaatgcacaacaagcttattgaagatatg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128071 |
gatcaacaagaagaaatgcacaacaagcttattgaagatatg |
36128030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University