View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_47 (Length: 295)
Name: NF8926_low_47
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 38413090 - 38412817
Alignment:
| Q |
1 |
aattaagacaaaacagaatattggaaacgttctcttcttcttattgttcttgttctctacacaaatcaaattaaacatggctggtgctgctttctttgca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38413090 |
aattaagacaaaacaaaatattggaaacgttctcttcttcttattgttctcgttctctacacaaatcaaattaaacatggctggtgctgctttctttgca |
38412991 |
T |
|
| Q |
101 |
attactactactactaccgcgcactgctctccccaattggttcgcgttccaatcactcatacnnnnnnnnnnnntcgatcttcaacaccaattctcaatc |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38412990 |
attactacta---ctaccgcgcactgctctccccaattggttcgcgttccaatcactcatacctctctctcttttcgatcttcaacaccaattctcaatc |
38412894 |
T |
|
| Q |
201 |
gccgttttagccctaaacctctctctattcgatcactttccgtttctgcttccggtaagccccttttccctctttca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38412893 |
gccgttttagccctaaacctctctctattcgatcactttccgtttctgcttccggtaagccccttttccctctttca |
38412817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University