View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_52 (Length: 287)
Name: NF8926_low_52
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 36710218 - 36710488
Alignment:
| Q |
1 |
tataaaaagtatctttgctaattgagacacttaattacctttcttggactggtttgaatactatatcctttaatcattcaatatcatcactaattatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36710218 |
tataaaaagtatctttgctaattgagacacttaattacctttcttggactggtttgaatactatatcctttaatcattcaatatcatcactaattatgaa |
36710317 |
T |
|
| Q |
101 |
actttaaaaaatttatatgatagaatatagtacaataacttaggttatgtggtcacgcagctatgagaggtaccgatgatactatagattgataaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36710318 |
actttaaaaaatttatatgatagaatatagtacaataacttaggttatgtggtcacgcagctatgagaggtaccgatgatactatagattgataaaattt |
36710417 |
T |
|
| Q |
201 |
attaagacatatggttattcacaatgcaagcaaagcacatgtcagtgaaaatgggattgtagatgattggt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36710418 |
attaagacatatggttattcacaatgcaagcaaagcacatgtcagtgaaaatgggattgtagatgattggt |
36710488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University