View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_56 (Length: 272)
Name: NF8926_low_56
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 47627837 - 47627605
Alignment:
| Q |
17 |
atatgtatatcataaaaaattacgagcttgttaaaacaacaacctttaattttctcactataagt-agtcacctttgaggatccaaacgactttctatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
47627837 |
atatgtatatcataaaaaattacgagcttgttaaaacaacaacctttaattttctcactatatgttagtcacctttgaggaaccaaaccactttctatca |
47627738 |
T |
 |
| Q |
116 |
taataaccataacattttttaatcgactttgtataaaatatttagtttgttgcagagtcttttaacaatagtctacgaaaaaggtttataaatgtaacta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47627737 |
taataaccataacattttttaatcgactttgtataaaatatttagtttgttgcagagtcttttaacaatagtctacgaaaaaggtttataaatgtaacta |
47627638 |
T |
 |
| Q |
216 |
tacaactagtaaaatatttgataaggtacttga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47627637 |
tacaactagtaaaatatttgataaggtacttga |
47627605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University