View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_57 (Length: 262)
Name: NF8926_low_57
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 2135290 - 2135537
Alignment:
| Q |
1 |
gaatcacatgacttctgtgcagacaagcatgaaaatttaaaga--acatttgaaaaagtatgatcaaaatgatcctcaaattgcaattcaattacgtacc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2135290 |
gaatcacatgacttctgtgcagacaagcatgaaaatttaaagataacatttgaaaaagtatgatcaaaatgatcctcaaattgcaattcaattacgtacc |
2135389 |
T |
|
| Q |
99 |
gaaggaatgtaatggatggagaatgagtcaaagttattcctcaacttcatagcctcaagacataacttccttaaattcccatcagccgtttgccatggtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2135390 |
gaaggaatgtaatggatggagaatgagtcaaagttattcctcaacttcatagcctcaagacataacttccttaaattcccatcagccgtttgccatggct |
2135489 |
T |
|
| Q |
199 |
ccccaaactgttgcaaagcaataatatatgcgcctaaattgtttaaaa |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2135490 |
ccccaaactgttgcaaagcaataacatatgcgcctaaattgtttaaaa |
2135537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University