View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8926_low_59 (Length: 261)
Name: NF8926_low_59
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8926_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 42699901 - 42699670
Alignment:
| Q |
20 |
aactgaaatgcaaaaactagaactcaaagaagatcacagactatgaaaccatttggacaaacatttttaaacatatagaagaacaaaaatatgcaacaaa |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42699901 |
aactgaaatgcaaaaactagaattcaaagaagatcacagactatgaaaccatttggacaaacatttttaaacatatagaagaacaaaaa-atgcaacaaa |
42699803 |
T |
 |
| Q |
120 |
atttacaaggaaaatatatacgtatatataaagccattcatggcttttcagtttgagaatattaagtttttgagacaagaaacaaatttcttacatgttt |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42699802 |
atttacaaggaaaatatatatgtatatataaagccattcatggcttttcagtttgagaatattaagtttttgagacaagaaacaaatttcttacatgttt |
42699703 |
T |
 |
| Q |
220 |
ttgaggaaggaaagaatagtggagtataatcta |
252 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
42699702 |
ttgaggaaggaaagaatagtggagtagaatcta |
42699670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University