View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8926_low_65 (Length: 240)

Name: NF8926_low_65
Description: NF8926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8926_low_65
NF8926_low_65
[»] chr7 (2 HSPs)
chr7 (25-223)||(279171-279369)
chr7 (95-156)||(265576-265637)


Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 279369 - 279171
Alignment:
25 tcaaaagatatttcatgaaagaaggagccaagccaattgaattttaattaaccaaaccaacnnnnnnnntcaaattcaggaacagcaagaaaagtagcta 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||    
279369 tcaaaagatatttcatgaaagaaggagccaagccaattgaattttaattaaccaaaccaacaaaaaaaatcaaattcaggaacagcaagaaaagtagcta 279270  T
125 tggttttgcttggatgcagtgttgctattgttaatatcataaacaacgagagctaatatagcacattgagccgtcaactggcgtctggcgctatcaaaa 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
279269 tggttttgcttggatgcagtgttgctattgttaatatcataaacaacgagagctaatatagcacattgagccgtcaactggcgtctggcactatcaaaa 279171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 156
Target Start/End: Complemental strand, 265637 - 265576
Alignment:
95 caaattcaggaacagcaagaaaagtagctatggttttgcttggatgcagtgttgctattgtt 156  Q
    ||||||||||||||||||||||| ||||  | | |||||||||||| || ||||| ||||||    
265637 caaattcaggaacagcaagaaaaatagcctttgctttgcttggatgtagagttgccattgtt 265576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University